Biotechnology Flow

Small non-coding RNA molecules (~20-24 nt) that silence genes post-transcriptionally by binding target mRNA 3' UTRs via the RISC complex.

hsa-miR-21-5p targets PTEN and PDCD4 tumor suppressors — overexpressed in most human cancers.

Text format storing nucleotide sequences with per-base Phred quality scores encoded as ASCII characters. Standard output of Illumina NGS.

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCG
+
!''*((((***+))%%%++)(%%%%

Single-stranded RNA transcribed from DNA that carries the genetic blueprint from nucleus to ribosome for protein synthesis.

COVID-19 mRNA vaccines encode the spike protein — the first approved human therapeutics using synthetic mRNA.

Programmable genome editing system using a guide RNA to direct the Cas9 endonuclease to cut specific DNA sequences, enabling precise insertions or deletions.

CASGEVY (2023) — first FDA-approved CRISPR therapy, cures sickle cell disease by reactivating fetal hemoglobin.

Comprehensive sequencing of an entire organism's genome, determining all ~3.2 billion base pairs in humans.

WGS of tumor biopsies identifies somatic mutations driving cancer, enabling precision oncology treatment decisions.

Physical process by which a linear polypeptide chain acquires its characteristic 3D structure determined by its amino acid sequence.

AlphaFold2 (DeepMind, 2021) predicts protein structures with near-atomic accuracy, solving the 50-year protein folding problem.

High-throughput sequencing of the transcriptome — all RNA molecules — to measure gene expression levels across thousands of genes simultaneously.

Single-cell RNA-seq (scRNA-seq) reveals distinct transcriptional states in individual cancer cells within a tumor.

Chromatin Immunoprecipitation followed by sequencing to map protein-DNA interactions, histone modifications, and transcription factor binding sites genome-wide.

H3K27ac ChIP-seq identifies active enhancers and super-enhancers that drive oncogene expression.

Third-generation sequencing technology that passes DNA/RNA through a protein nanopore, detecting base-specific current disruptions to read ultra-long sequences in real time.

Oxford Nanopore MinION enables field sequencing of Ebola virus genomes during outbreaks in remote locations.

CRISPR-derived tool that chemically converts one DNA base to another (e.g. C→T or A→G) without creating double-strand breaks, reducing off-target effects.

ABE8e (adenine base editor) corrects pathogenic A→G point mutations causally linked to hemophilia and Hutchinson-Gilford progeria.

Heritable changes in gene expression that do not alter DNA sequence — mediated by DNA methylation, histone modification, and chromatin remodeling.

CpG island methylation silences tumor suppressor genes like BRCA1, driving cancer without any mutation in the coding sequence.

Non-invasive diagnostic technique analyzing circulating tumor DNA (ctDNA), exosomes, or circulating tumor cells shed from tumors into blood.

Guardant360 liquid biopsy detects EGFR mutations in lung cancer patients too fragile for surgical tissue biopsy.

Deep learning model by DeepMind that predicts protein 3D structures from amino acid sequences with near-experimental accuracy using attention-based neural networks.

AlphaFold2 predicted structures for >200 million proteins in the UniProt database, releasing all predictions as open science.

DNA or RNA sequence beginning with a start codon (ATG) and ending with a stop codon (TAA/TAG/TGA), representing a potential protein-coding region.

The SARS-CoV-2 genome contains 14 ORFs encoding structural, non-structural, and accessory proteins totalling ~30,000 nucleotides.

Assay for Transposase-Accessible Chromatin using sequencing. Maps open chromatin regions (accessible DNA) across the genome to identify active regulatory elements.

ATAC-seq on single cancer cells reveals epigenetic heterogeneity within tumors predicting therapy resistance.

Meta AI's large language model for protein structure prediction, trained on 250 million protein sequences, enabling rapid structure inference without multiple sequence alignment.

ESMFold predicts structures 60x faster than AlphaFold2, enabling large-scale proteome annotation of metagenomic data.

Search-and-replace genome editing strategy using a pegRNA + nicking Cas9 + reverse transcriptase to install any base change, small insertions or deletions without DSBs.

PE3 prime editing corrects the ΔF508 CFTR mutation responsible for 70% of cystic fibrosis cases in human cells.

Percentage of nitrogenous bases in a DNA/RNA sequence that are guanine or cytosine. Affects duplex stability, primer design, and codon usage bias.

Human promoter regions average ~60% GC content. Mycobacterium tuberculosis genome is ~65% GC — affecting gene regulation strategies.

Single base-pair variation at a specific locus in the genome occurring in ≥1% of a population. Most common form of genetic variation.

GWAS studies of ~1 million SNPs link rs7903146 in TCF7L2 to 40% increased risk of type 2 diabetes.

Bioinformatic algorithm for predicting miRNA target sites by finding the minimum free energy (MFE) hybridization of small RNA to large RNA using dynamic programming.

NanoSynapse Engine v4.0 implements RNAhybrid-style sliding window search with ViennaRNA thermodynamic scoring for target prediction.